SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

SmartGene exhibiting at ASM's Clinical Virology Symposium (Booth #415)

If you will be attending the 2023 ASM Clinical Virology Symposium, please visit us in the Exhibit Hall.

Are you curious about how to choose and implement sequencing technologies for routine applications in Microbiology and Virology?  Practical solutions are available from SmartGene for the analysis and interpretation of Sanger and Next Generation Sequencing (NGS) data.
  
When & Where:  September 9th-11th @ the Palm Beach County Convention Center in West Palm Beach, Florida, SmartGene Booth #415
 
Are you and your colleagues interested in sequence-based identification of bacteria and fungi? Are you considering Microbiome analysis?  
  • Gut, skin, mucosal, and oral microbiomes are recognized as important biomarkers for monitoring various diseases, lifestyle effects, and for guiding treatment decisions.
  • Stop by our booth to learn about our latest Apps including SmartGene® BiomeScan™. 
  • Our pipelines incorporate the proprietary SmartGene® Centroid reference databases to produce more specific and precise results to achieve a granular understanding of the microbiota and its potential role in health and disease.
  • Upon visiting our booth, you can get an overview of SmartGene’s solutions for Sanger and NGS data analysis, interpretation, and reporting.
  • SmartGene provides bridging technologies to ensure continuity of valuable genetic data over time for your infectious disease sequencing needs.

We hope to see you in West Palm Beach!

  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2023 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format