SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

New HIV Article by SmartGene customer

 Read a recently published article about an HIV Sequencing Method

At SmartGene, we are deeply committed to empowering healthcare professionals with cutting-edge technologies, facilitating next-generation data analysis, and revolutionizing patient care. We are delighted to share a study conducted by one of our valued customers at CENTRE HOSPITALIER DE VERSAILLES highlighting the efficacy and precision of bioinformatic analyses, setting new standards in HIV research: "The bioinformatic analyses were performed using the Advanced Sequencing Platform (ASP) v3.13.0 available from SmartGene (SmartGene, Lausanne, Switzerland). The SmartGene HIV-1 application is based on the proprietary IDNS (Integrated Database Network System) technology of SmartGene and is accessible via a secure web interface, which can handle base called sequencing files generated through different sequencing technologies."

Read the full article via our Scientific Publications tab here to explore the transformative potential of collaborative research and innovative sequencing methodologies: Optimization of HIV Sequencing Method Using Vela Sentosa Library on MiSeq Illumina Platform.

  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
    • Certifications
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2026 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format