SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Home
  • Our Services
    • Modules
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • 16S Microbiome
      • HIV
      • HCV
      • Influenza
      • Coronavirus
      • Typing
      • NGS Pipelines
      • Other modules
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Home
  • Our Services
    • Modules
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • 16S Microbiome
      • HIV
      • HCV
      • Influenza
      • Coronavirus
      • Typing
      • NGS Pipelines
      • Other modules
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
May 04 2022
New Releases of SmartGene's ASP and NGS

As a part of the continuous enhancement of our Services, we have released a new version of our ASP Platform (IDNS® 5 v3.10.0).  A new version of our NGS pipelines (v2.5.0) also comes with this release.

view details
April 22 2022
Notice of Office Relocation

SmartGene, headquartered in Switzerland, has a new address.

view details
April 12 2022
Update to IDNS 16S Bacteria Centroids

The SmartGene Bacteria 16S module continues to grow to cover more species.

view details
March 21 2022
New Releases of SmartGene's ASP and NGS

As a part of the continuous enhancement of our Services, we have released new versions of our ASP Platform (v3.9.4) and NGS Pipelines (v2.4.6).

view details
January 24 2022
ANRS Algorithm for HIV-1 drug resistance interpretation

Version 32 of the ANRS HIV-1 algorithm has been implemented on the SmartGene IDNS® Service platforms.

view details
August 11 2021
New functionalities for the SARS-CoV-2 Pipeline

A new version of the SmartGene NGS Coronavirus Analysis Pipeline has been implemented.

view details
March 18 2021
Stanford HIVdb update implemented

The HIV genotypic drug resistance algorithm within SmartGene for Stanford HIVdb has been updated to version 9.0.0. 

view details
February 11 2021
SmartGene's Coronavirus Modules broadly adopted across France

SmartGene services to be used for the local detection of SARS-CoV-2 variants and national surveillance across France.

view details
October 27 2020
New Publication in ASM's Clinical Microbiology Reviews
SmartGene's scientists are co-authors of an important, wide-ranging article which addresses the role of gene sequencing for the specific identification and characterization of bacteria. Published by the American Society for Microbiology in Clinical Microbiology Reviews, the article is entitled: Performance and Application of 16S rRNA Gene Cycle Sequencing for Routine Identification of Bacteria in the Clinical Microbiology Laboratory.
view details
October 14 2020
SmartGene Bacteria Technology Featured in new Application Note published by Thermo Fisher Scientific

SmartGene's Bacteria Module is the perfect complement to the Applied Biosystems SeqStudio™ Genetic Analyzer. 

view details

Page 1 of 3

  • 1
  • 2
  • 3
  • »
  • End
  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2022 SmartGene AG. All rights reserved.
  • Home
  • Our Services
    • Modules
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • 16S Microbiome
      • HIV
      • HCV
      • Influenza
      • Coronavirus
      • Typing
      • NGS Pipelines
      • Other modules
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format