SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
September 03 2025
New Publication: Bacteria 16S Methods Evaluated, SmartGene used as validation method

A new publication from our colleagues at Versailles Central Hospital, France is now available. The article evaluates an alternative next-generation sequencing process for the identification of 16S Bacteria.  The article includes details about the effectiveness of SmartGene's Centroid-based analysis for Bacteria 16S sequencing and the use of SmartGene as a validation method.  SmartGene offers automated analysis and identification tools for both next generation and dideoxynucleotide sequencing for targets including Bacteria and Fungi.

view details
June 27 2025
Recent Article by a SmartGene customer and collaborator

We’re happy to share a new publication from our collaborators at Johns Hopkins. The article highlights the effectiveness of SmartGene's Centroid-based analysis for Bacteria 16S sequencing.  Automated analysis and identification tools from SmartGene are available for both next generation and dideoxynucleotide sequencing for targets including Bacteria and Fungi.

view details
February 11 2025
Stanford's HIVDB 9.8 implemented

The HIV genotypic drug resistance algorithm within SmartGene for Stanford HIVDB has been updated. 

view details
August 12 2024
New Article by a SmartGene customer and collaborator

We’re happy to share a new publication from our collaborators at the Laboratory of Microbiology of the University of Neuchâtel. The article highlights the effectiveness of SmartGene's Centroid-based approach in combating food fraud.

Food fraud is a big challenge in the food industry, and morel mushrooms are no exception. Traditional methods to identify true morels often lack accuracy. Using SmartGene's proprietary, curated reference databases, the authors achieved an impressive 83% accuracy in identifying morel species, compared to just 36% and 47% using traditional tools. 

view details
June 21 2024
SmartGene Apps & Lab Accreditation

Laboratory Accreditation: Ensuring Quality and Competence in Testing

Dr Coralie Kerestedjan-Pallier, Hospital Practicioner in France, who recently achieved COFRAC accreditation, attests to the effectiveness of our solution and the value of SmartGene's Customer Support Team in providing assistance and documentation for the SmartGene Apps during their recent accreditation process:

view details
May 03 2024
Update of the ANRS Interpretation Algorithm for HIV-1 & HIV-2

Version 35 of the ANRS HIV-1 and Version 31 of the ANRS HIV-2 algorithms have been implemented for the SmartGene IDNS® Apps.

view details
March 11 2024
New HIV Article by SmartGene customer

 Read a recently published article about an HIV Sequencing Method

view details
February 21 2024
New release of 16S Centroid APPs for NGS data analysis

New release of several 16S Centriod Apps (IDNS® 5 v3.14.0 and NGS v2.9.0).

view details
December 08 2023
ISO 27001 Certification

SmartGene has received certification in accordance with the requirements of the ISO/IEC 27001:2013 Standard.

view details
December 08 2023
HDS Certification, Bureau Veritas

SmartGene has received certification in accordance with the requirements of the HDS Standard.

view details
August 22 2023
Update of IDNS 16S Bacteria Centroids

The SmartGene Bacteria 16S module continues to grow to cover more species.

view details
July 06 2023
Influenza references updated for 23-24 Season

The reference sequences available in SmartGene's Influenza module have been updated.

view details
June 20 2023
SmartGene Technology Featured in White Paper Published by Promega

Promega's workflow solutions for sample extraction through sequencing, together with SmartGene's convenient and action-oriented analysis Apps, offer an accessible alternative to outsourcing sequence-based identification of organisms.  SmartGene's Web Apps guide the user from .ab1 files to final report generation, requiring no local hardware, specific software, nor bioinformatics staff.    A new White Paper is now available, A Sample-to-Action Solution for Microbial identification:  Sequencing on the [Promega] Spectrum Compact CE System with SmartGene Analysis. 

view details
February 17 2023
New article available regarding SmartGene's BiomeScan Apps for Microbiome analysis

Reliable and reproducible microbiome testing in clinical practice requires standardization of methods and comprehensive, representative, up-to-date reference databases. In a new article published in PLOS One, read how SmartGene's BiomeScan®Apps for Microbiome analysis and SmartGene's proprietary Centroid reference databases can meet these needs.

For a summary, click here to go to SmartGene's Scientific Publications Section for Microbiology on this website.

view details
January 06 2023
SARS-CoV-2 XBB.1.5

We are closely following the epidemiology of the SARS-CoV-2 variants in order to update our reference database, the SARS-CoV-2 Variant Typing Dataset (in our Coronavirus App).

view details
December 06 2022
SARS-CoV-2 Omicron BF.7 Sublineages

We have updated our reference database, the SARS-CoV-2 Variant Typing Dataset.

view details
December 01 2022
New Release of SmartGene's Next Gen Apps

As a part of the continuous enhancement of our Services, we released a new version of our ASP Platform (IDNS® 5 v3.11.0).  A new version of our NGS pipelines (v2.6.0) also comes with this release.

view details
September 06 2022
SmartGene and Illumina announce Collaboration

SmartGene and Illumina announce their collaboration to promote broad adoption of next generation sequencing for routine testing.

view details
August 24 2022
SmartGene and Johns Hopkins to evaluate the suitability of NGS for routine clinical microbiology laboratories

SmartGene announces a new collaboration with The Johns Hopkins University clinical microbiology division to study various sequencing technologies for bacterial and fungal identification.

view details
April 22 2022
Notice of Office Relocation

SmartGene, headquartered in Switzerland, has a new address.

view details
August 11 2021
New functionalities for the SARS-CoV-2 Pipeline

A new version of the SmartGene NGS Coronavirus Analysis Pipeline has been implemented.

view details
February 11 2021
SmartGene's Coronavirus Modules broadly adopted across France

SmartGene services to be used for the local detection of SARS-CoV-2 variants and national surveillance across France.

view details
October 27 2020
New Publication in ASM's Clinical Microbiology Reviews
SmartGene's scientists are co-authors of an important, wide-ranging article which addresses the role of gene sequencing for the specific identification and characterization of bacteria. Published by the American Society for Microbiology in Clinical Microbiology Reviews, the article is entitled: Performance and Application of 16S rRNA Gene Cycle Sequencing for Routine Identification of Bacteria in the Clinical Microbiology Laboratory.
view details
October 14 2020
SmartGene Bacteria Technology Featured in new Application Note published by Thermo Fisher Scientific

SmartGene's Bacteria Module is the perfect complement to the Applied Biosystems SeqStudio™ Genetic Analyzer. 

view details
April 28 2020
SmartGene announces new SaaS Module for Coronaviruses

Genetic analyses of SARS-CoV-2 and other Coronaviridae will have an increasingly important role to play, both in the current fight against COVID-19 and in preventing future epidemics of Coronaviridae.

view details
January 23 2020
Hepatitis Collaboration

SmartGene announces a clinical research collaboration with France's Centre of Excellence for the study and treatment of hepatitis viruses at the Virology Laboratory and National Reference Center for Viral Hepatitis B, C, and delta at Hospital Henri Mondor, University Paris-Est, Paris, France.

view details
September 12 2019
Fungal 25-28S references updated

The IDNS Fungi 25-28S Reference Database has been reconfigured to improve coverage and species representation. 

view details
January 15 2019
21 CFR Part 11 Certification

SmartGene receives certification of compatibility regarding the requirements of Title 21 Part 11 of the US Code of Federal Regulations.

view details
June 07 2017
On day one of the 15th European Meeting on HIV & Hepatitis in Rome, Italy, 7-9 June 2017

Professor Anne-Geneviève Marcelin of Pitié-Salpêtrière Hospital Sorbonne, Paris, France presented the findings of a study based on data collected and analyzed using tools and search algorithms which SmartGene has made available for this purpose: Epidemiological study of Doravirine associated resistance mutations in HIV-1-infected treatment-naïve patients from two large databases in France and Italy.

view details
November 11 2016
SmartGene announces Advanced Sequence Analysis Platform for NGS

With the release of version 5.3, SmartGene has applications available for HIV, Microbiome 16S, and HCV.

view details
July 01 2015
CE-IVD labeling obtained for HIV-1, HCV, Bacteria and Fungi Modules from SmartGene

Following a successful notification to Swissmedic, the Swiss Agency for Therapeutic Products, SmartGene announces that the SmartGene Service Modules for HIV, HCV, Bacteria, Fungi, and HLA have obtained CE-IVD labeling.

view details
October 08 2014
Ruling by The Supreme Court of the United States affirms invalidation of patents

Order by Supreme Court of the United States confirms SmartGene’s success invalidating patents which threatened the practice of personalized medicine.

view details
October 23 2013
SmartGene and the University of Zürich evaluate a completely automated tool for 16S sequence analysis to the species level

Poster presented at the Medical Biodefense Conference in Munich, Germany.

view details
May 12 2012
SmartGene becomes an official provider of services to the network of public hospitals in Paris, France

SmartGene becomes an official Service Provider to the Public Hospital Laboratories AP-HP in Paris, France.

view details
November 16 2011
Availability of curated reference databases to aid in sequence-based identification of Nocardia species

SmartGene Inc. announces the availability of curated reference databases to aid in sequence-based identification of Nocardia species.

view details
August 15 2011
SmartGene and the Institute of Medical Microbiology, University of Zürich, expand their collaboration

SmartGene and the Institute of Medical Microbiology, University of Zurich expand their collaboration to address the sequence-based validation of mass spectrometry platforms for clinical microbiology.

view details
July 30 2009
SmartGene's Services for Identification of Bacteria and Fungi to be used by The Johns Hopkins Hospital

SmartGene's Services for faster, more precise identification of Bacteria and Fungi to be used by the Johns Hopkins Hospital.

view details
May 11 2007
SmartGene Services, SARL joins the BIOTRACER Consortium

SmartGene has recently signed a contract to develop a data-analysis and data-management system dedicated to the typing of Campylobacter species as part of a European Union Consortium project called BIOTRACER.

view details
February 20 2007
SmartGene Inc. and LabCorp enter into a collaboration

SmartGene Inc. and LabCorp enter into a collaboration for faster, more precise identification of Bacteria and Fungi by sequence analysis.

view details
  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
    • Certifications
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2026 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format