SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Home
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Home
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
February 17 2023
New article available regarding SmartGene's BiomeScan Apps for Microbiome analysis

Reliable and reproducible microbiome testing in clinical practice requires standardization of methods and comprehensive, representative, up-to-date reference databases. In a new article published in PLOS One, read how SmartGene's BiomeScan Apps for Microbiome analysis and SmartGene's proprietary Centroid reference databases can meet these needs.

For a summary, click here to go to SmartGene's Scientific Publications Section for Microbiology on this website.

view details
January 06 2023
SARS-CoV-2 XBB.1.5

We are closely following the epidemiology of the SARS-CoV-2 variants in order to update our reference database, the SARS-CoV-2 Variant Typing Dataset (in our Coronavirus App).

view details
December 15 2022
Stanford's HIVDB 9.4 update implemented

The HIV genotypic drug resistance algorithm within SmartGene for Stanford HIVDB has been updated. 

view details
December 06 2022
SARS-CoV-2 Omicron BF.7 Sublineages

We have updated our reference database, the SARS-CoV-2 Variant Typing Dataset.

view details
December 01 2022
New Release of SmartGene's Next Gen Apps

As a part of the continuous enhancement of our Services, we released a new version of our ASP Platform (IDNS® 5 v3.11.0).  A new version of our NGS pipelines (v2.6.0) also comes with this release.

view details
October 20 2022
ANRS Interpretation Algorithm for HIV-1 drug resistance

Version 33 of the ANRS HIV-1 algorithm has been implemented on the SmartGene IDNS® Service platforms.

view details
September 06 2022
SmartGene and Illumina announce Collaboration

SmartGene and Illumina announce their collaboration to promote broad adoption of next generation sequencing for routine testing.

view details
August 24 2022
SmartGene and Johns Hopkins to evaluate the suitability of NGS for routine clinical microbiology laboratories

SmartGene announces a new collaboration with The Johns Hopkins University clinical microbiology division to study various sequencing technologies for bacterial and fungal identification.

view details
April 22 2022
Notice of Office Relocation

SmartGene, headquartered in Switzerland, has a new address.

view details
April 12 2022
Update to IDNS 16S Bacteria Centroids

The SmartGene Bacteria 16S module continues to grow to cover more species.

view details

Page 1 of 3

  • 1
  • 2
  • 3
  • »
  • End
  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2023 SmartGene AG. All rights reserved.
  • Home
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format