SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

SmartGene Bacteria Technology Featured in new Application Note published by Thermo Fisher Scientific

SmartGene's Bacteria Module is the perfect complement to the Applied Biosystems SeqStudio™ Genetic Analyzer. 

A new Application Note has been published by Thermo Fisher Scientific entitiled The 16S Direct workflow: Microbial identification using 16S gene sequencing on the SeqStudio Genetic Analyzer and analysis with the SmartGene web application. So, if you are looking for a fast and economical system for 16S bacterial identification at the species level by PCR and Sanger sequencing, here are the steps to consider: 

  1. Review the 16S Direct method (discussed in the Application Note)
  2. Determine the suitability of the Applied Biosystems SeqStudio Genetic Analyzer
  3. Subscribe to SmartGene's Bacteria module for SeqStudio for sequence data management, interpretation, and report creation: 
    • Delivers sequence-based identification of microbial species
    • Reliably differentiates closely related species
    • 16S Centroid database and updating process
    • Regularly updated for new organisms, recent taxonomy, and synonyms without user intervention
    • Keeps data safe, independent from source, and accessible 24x7 in the secure, SmartGene environment.

  • To read the announcement, please click here.
  • To view the first page of the Application Note, please click here.
  • To request a copy of the full Application Note, please contact us via the following link:  This email address is being protected from spambots. You need JavaScript enabled to view it.
  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
    • Certifications
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2025 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format