SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

NEWS

20 Jun 2023
SmartGene Technology Featured in White Paper Published by Promega

Promega's workflow solutions for sample extraction through sequencing, together with SmartGene's convenient and action-oriented analysis Apps, offer an accessible alternative to outsourcing sequence-based identification of organisms.  SmartGene's Web Apps guide the user from .ab1 files to final report generation, requiring no local hardware, specific software, nor bioinformatics staff.    A new White Paper is now available, A Sample-to-Action Solution for Microbial identification:  Sequencing on the [Promega] Spectrum Compact CE System with SmartGene Analysis. 

view details
20 Jul 2023
SmartGene exhibiting at ASM's Clinical Virology Symposium (Booth #415)
view details
17 Feb 2023
New article available regarding SmartGene's BiomeScan Apps for Microbiome analysis

Reliable and reproducible microbiome testing in clinical practice requires standardization of methods and comprehensive, representative, up-to-date reference databases. In a new article published in PLOS One, read how SmartGene's BiomeScan Apps for Microbiome analysis and SmartGene's proprietary Centroid reference databases can meet these needs.

For a summary, click here to go to SmartGene's Scientific Publications Section for Microbiology on this website.

view details
06 Sep 2022
SmartGene and Illumina announce Collaboration

SmartGene and Illumina announce their collaboration to promote broad adoption of next generation sequencing for routine testing.

view details
all news

  • Contact Headquarters
  • Contact North America
Virology
Microbiology
Human Genetics
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2023 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format