SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Home
  • Our Services
    • Modules
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • 16S Microbiome
      • HIV
      • HCV
      • Influenza
      • Coronavirus
      • Typing
      • NGS Pipelines
      • Other modules
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Home
  • Our Services
    • Modules
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • 16S Microbiome
      • HIV
      • HCV
      • Influenza
      • Coronavirus
      • Typing
      • NGS Pipelines
      • Other modules
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

NEWS

12 Jul 2022
SARS-CoV-2 Omicron BA.2 Sublineages

We are closely following the epidemiology of the SARS-CoV-2 variants in order to update our reference database, the SARS-CoV-2 Variant Typing Dataset.

view details
29 Jun 2022
Stanford's HIVdb update implemented

The HIV genotypic drug resistance algorithm within SmartGene for Stanford HIVdb has been updated to version 9.1.0 (June 2022). 

view details
17 Jun 2022
SARS-CoV-2 Omicron BA.5 Sublineages

We are closely following the epidemiology of the SARS-CoV-2 variants in order to update our reference database, the SARS-CoV-2 Variant Typing Dataset.

view details
12 Apr 2022
Update to IDNS 16S Bacteria Centroids

The SmartGene Bacteria 16S module continues to grow to cover more species.

view details
all news

  • Contact Headquarters
  • Contact North America
Virology
Microbiology
Human Genetics
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2022 SmartGene AG. All rights reserved.
  • Home
  • Our Services
    • Modules
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • 16S Microbiome
      • HIV
      • HCV
      • Influenza
      • Coronavirus
      • Typing
      • NGS Pipelines
      • Other modules
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format