SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

New functionalities for the SARS-CoV-2 Pipeline

A new version of the SmartGene NGS Coronavirus Analysis Pipeline has been implemented.

This latest relase (v3.9.2) makes it easier to monitor the genetic diversity of the Cornoaviridae and to contribute reliable data into the various SARS-CoV-2 community surveillance projects.

This update of the SmartGene Coronavirus Module includes the following features:

  • data analysis from third generation sequencing systems
  • integrated analysis, allowing detection of mutations and easy subtyping
  • exportation of results in tabular format for several genomes at once
  • direct generation of output tables including genomic data for various projects to minimize user involvement.

Of course, the new release continues to offer batch upload and processing capabilities as well as the ability to export genomic sequences in a variety of formats.

Please visit our Coronavirus Module webpage or This email address is being protected from spambots. You need JavaScript enabled to view it. to request more information about our solutions for Coronavirus sequence analysis.

  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
    • Certifications
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2026 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format