SmartGene announces a new collaboration with The Johns Hopkins University clinical microbiology division to study various sequencing technologies for bacterial and fungal identification.
Click here to read the full announcement.
-
Clinical DiagnosticsGene sequence interpretation for precision medicineCAGGTGGCTCTTGCAACTGGA -
Medical ResearchLeveraging gene sequence data to drive new insightCAGGTGGCTCTTGCAACTGGA
-
Public HealthEnabling molecular epidemiologyCAGGTGGCTCTTGCAACTGGA
-
BioPharmaGene sequence analysis for product qualityCAGGTGGCTCTTGCAACTGGA
-
Food IntegrityAssuring authenticity, safety, and qualityCAGGTGGCTCTTGCAACTGGA