SmartGene's Services for faster, more precise identification of Bacteria and Fungi to be used by the Johns Hopkins Hospital.
-
Clinical DiagnosticsGene sequence interpretation for precision medicineCAGGTGGCTCTTGCAACTGGA -
Medical ResearchLeveraging gene sequence data to drive new insightCAGGTGGCTCTTGCAACTGGA
-
Public HealthEnabling molecular epidemiologyCAGGTGGCTCTTGCAACTGGA
-
BioPharmaGene sequence analysis for product qualityCAGGTGGCTCTTGCAACTGGA
-
Food IntegrityAssuring authenticity, safety, and qualityCAGGTGGCTCTTGCAACTGGA