SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

Recent Article by a SmartGene customer and collaborator

We’re happy to share a new publication from our collaborators at Johns Hopkins. The article highlights the effectiveness of SmartGene's Centroid-based analysis for Bacteria 16S sequencing.  Automated analysis and identification tools from SmartGene are available for both next generation and dideoxynucleotide sequencing for targets including Bacteria and Fungi.


ABSTRACT: Sanger sequencing of the first ~500 bp of the 16S rRNA gene is frequently used to identify bacterial pathogens that have ambiguous biochemical profiles or proteomic mass spectra. When diversity does not occur within that region, genus-level and/or species-level identification may not be possible, and a longer sequence or alternative target may be required to distinguish between genera/species. In this study, we evaluated a clinically relevant end-to-end solution for long-read (~1,500 nt) 16S rRNA next-generation sequencing by Oxford Nanopore Technologies (ONT) compared to a ~500 nt Sanger sequencing approach for the identification of 153 bacterial clinical isolates. Sequencing data were analyzed using the IDNS software from SmartGene and its proprietary 16S Centroid reference database (Centroid database) SmartGene software and the Centroid database. The agreement of the two platforms on species-and genus-level identification was determined, and discrepancies were resolved by whole-genome sequencing. ONT had a higher taxonomic resolution at the genus level (P < 0.01). When genus-level identification was achieved by both methods, concordance to the best matching genus was 100%. When species-level identification was achieved by both methods, concordance to the best matching species was 91%. The costs per test were ~$25.30 (when multiplexing 24 samples/run) and $74 for ONT and Sanger sequencing, respectively. The hands-on time spent performing sequencing was similar for both methods, but the turnaround time of ONT was significantly shorter than that of Sanger sequencing.

Read the full article found in our Scientific Publications section here.

  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
    • Certifications
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2026 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format