SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

NEWS

27 Jun 2025
Recent Article by a SmartGene customer and collaborator

We’re happy to share a new publication from our collaborators at Johns Hopkins. The article highlights the effectiveness of SmartGene's Centroid-based analysis for Bacteria 16S sequencing.  Automated analysis and identification tools from SmartGene are available for both next generation and dideoxynucleotide sequencing for targets including Bacteria and Fungi.

view details
11 Feb 2025
Stanford's HIVDB 9.8 implemented

The HIV genotypic drug resistance algorithm within SmartGene for Stanford HIVDB has been updated. 

view details
03 Jul 2024
New Article by a SmartGene customer and collaborator

We’re happy to share a new publication from our collaborators at the Laboratory of Microbiology of the University of Neuchâtel. The article highlights the effectiveness of SmartGene's Centroid-based approach in combating food fraud.

Food fraud is a big challenge in the food industry, and morel mushrooms are no exception. Traditional methods to identify true morels often lack accuracy. Using SmartGene's proprietary, curated reference databases, the authors achieved an impressive 83% accuracy in identifying morel species, compared to just 36% and 47% using traditional tools. 

view details
21 Jun 2024
SmartGene Apps & Lab Accreditation

Laboratory Accreditation: Ensuring Quality and Competence in Testing

Dr Coralie Kerestedjan-Pallier, Hospital Practicioner in France, who recently achieved COFRAC accreditation, attests to the effectiveness of our solution and the value of SmartGene's Customer Support Team in providing assistance and documentation for the SmartGene Apps during their recent accreditation process:

view details
all news

  • Contact Headquarters
  • Contact North America
Virology
Microbiology
Human Genetics
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2025 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format