SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
back to all news

Fungal Centroids and Fungal References updated

The IDNS® Fungal Centroid and Fungal Reference Databases have been refreshed to expand representation of fungal species and to update entries for synonyms and changes in nomenclature. 

Implemented on April 4, 2026, this update covers the Fungal targets for 18S, 25-28S (D1/D2), and ITS.  Each Fungal target has both a Centroid database and a much larger IDNS® Fungal Reference database.  All sequences involved in the Centroid process, having a valid species name or synonym, get the benefit of being annotated with Centroid statistics such as confidence values, species group size, and outlier status.  Each sequence that is the most representative of its species becomes a Centroid.  The SmartGene Centroid databases host only one sequence for each valid species name.  

Summary statistics for this update (r144u1247):

IDNS® ITS Fungi Centroids

  • 49,349 different species represented by a Centroid (6,294 Genera)
  • 1,103,810 Reference Sequences in the larger ITS database, IDNS® ITS Fungi References
  • Annual averages:  750 species renamed/removed, 2800 new species, and 950 Centroid changes/shifts

IDNS® D1/D2 Fungi Centroids

  • 38,316 different species represented by a Centroid (6,282 Genera)
  • 301,359 Reference Sequences in the larger D1/D2 database, IDNS® 25-28S D1-D2 Fungi References
  • Annual averages:  700 species renamed/removed, 2200 new species, and 400 Centroid changes/shifts

IDNS® 18S Fungi Centroids

  • 13,579 different species represented by a Centroid (4,059 Genera)
  • 99,797 Reference Sequences in the larger 18S database, IDNS® 18S Fungi References
  • Annual averages:  300 species renamed/removed, 700 new species, and 50 Centroid changes/shifts

SmartGene's Centroid annotation process is a patent-protected procedure of SmartGene AG #EP2215578.

  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
    • Certifications
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2026 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format