SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
February 11 2021
SmartGene's Coronavirus Modules broadly adopted across France

SmartGene services to be used for the local detection of SARS-CoV-2 variants and national surveillance across France.

view details
October 27 2020
New Publication in ASM's Clinical Microbiology Reviews
SmartGene's scientists are co-authors of an important, wide-ranging article which addresses the role of gene sequencing for the specific identification and characterization of bacteria. Published by the American Society for Microbiology in Clinical Microbiology Reviews, the article is entitled: Performance and Application of 16S rRNA Gene Cycle Sequencing for Routine Identification of Bacteria in the Clinical Microbiology Laboratory.
view details
October 14 2020
SmartGene Bacteria Technology Featured in new Application Note published by Thermo Fisher Scientific

SmartGene's Bacteria Module is the perfect complement to the Applied Biosystems SeqStudio™ Genetic Analyzer. 

view details
April 28 2020
SmartGene announces new SaaS Module for Coronaviruses

Genetic analyses of SARS-CoV-2 and other Coronaviridae will have an increasingly important role to play, both in the current fight against COVID-19 and in preventing future epidemics of Coronaviridae.

view details
January 23 2020
Hepatitis Collaboration

SmartGene announces a clinical research collaboration with France's Centre of Excellence for the study and treatment of hepatitis viruses at the Virology Laboratory and National Reference Center for Viral Hepatitis B, C, and delta at Hospital Henri Mondor, University Paris-Est, Paris, France.

view details
September 12 2019
Fungal 25-28S references updated

The IDNS Fungi 25-28S Reference Database has been reconfigured to improve coverage and species representation. 

view details
January 15 2019
21 CFR Part 11 Certification

SmartGene receives certification of compatibility regarding the requirements of Title 21 Part 11 of the US Code of Federal Regulations.

view details
June 07 2017
On day one of the 15th European Meeting on HIV & Hepatitis in Rome, Italy, 7-9 June 2017

Professor Anne-Geneviève Marcelin of Pitié-Salpêtrière Hospital Sorbonne, Paris, France presented the findings of a study based on data collected and analyzed using tools and search algorithms which SmartGene has made available for this purpose: Epidemiological study of Doravirine associated resistance mutations in HIV-1-infected treatment-naïve patients from two large databases in France and Italy.

view details
November 11 2016
SmartGene announces Advanced Sequence Analysis Platform for NGS

With the release of version 5.3, SmartGene has applications available for HIV, Microbiome 16S, and HCV.

view details
July 01 2015
CE-IVD labeling obtained for HIV-1, HCV, Bacteria and Fungi Modules from SmartGene

Following a successful notification to Swissmedic, the Swiss Agency for Therapeutic Products, SmartGene announces that the SmartGene Service Modules for HIV, HCV, Bacteria, Fungi, and HLA have obtained CE-IVD labeling.

view details
October 08 2014
Ruling by The Supreme Court of the United States affirms invalidation of patents

Order by Supreme Court of the United States confirms SmartGene’s success invalidating patents which threatened the practice of personalized medicine.

view details
October 23 2013
SmartGene and the University of Zürich evaluate a completely automated tool for 16S sequence analysis to the species level

Poster presented at the Medical Biodefense Conference in Munich, Germany.

view details
May 12 2012
SmartGene becomes an official provider of services to the network of public hospitals in Paris, France

SmartGene becomes an official Service Provider to the Public Hospital Laboratories AP-HP in Paris, France.

view details
November 16 2011
Availability of curated reference databases to aid in sequence-based identification of Nocardia species

SmartGene Inc. announces the availability of curated reference databases to aid in sequence-based identification of Nocardia species.

view details
August 15 2011
SmartGene and the Institute of Medical Microbiology, University of Zürich, expand their collaboration

SmartGene and the Institute of Medical Microbiology, University of Zurich expand their collaboration to address the sequence-based validation of mass spectrometry platforms for clinical microbiology.

view details
July 30 2009
SmartGene's Services for Identification of Bacteria and Fungi to be used by The Johns Hopkins Hospital

SmartGene's Services for faster, more precise identification of Bacteria and Fungi to be used by the Johns Hopkins Hospital.

view details
May 11 2007
SmartGene Services, SARL joins the BIOTRACER Consortium

SmartGene has recently signed a contract to develop a data-analysis and data-management system dedicated to the typing of Campylobacter species as part of a European Union Consortium project called BIOTRACER.

view details
February 20 2007
SmartGene Inc. and LabCorp enter into a collaboration

SmartGene Inc. and LabCorp enter into a collaboration for faster, more precise identification of Bacteria and Fungi by sequence analysis.

view details
  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2025 SmartGene AG. All rights reserved.
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format