SmartGene - Integrated Database Network SystemSmartGene - Integrated Database Network System
  • Home
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format

Simply Managing Complex Data

  • Home
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format
  • Slide Diagnostics
    Clinical Diagnostics
    Gene sequence interpretation for precision medicine
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Research
    Medical Research
    Leveraging gene sequence data to drive new insight
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Public Health
    Public Health
    Enabling molecular epidemiology
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Biopharma
    BioPharma
    Gene sequence analysis for product quality
    view details
    CAGGTGGCTCTTGCAACTGGA
  • Slide Food Integrity
    Food Integrity
    Assuring authenticity, safety, and quality
    view details
    CAGGTGGCTCTTGCAACTGGA
February 11 2021
SmartGene's Coronavirus Modules broadly adopted across France

SmartGene services to be used for the local detection of SARS-CoV-2 variants and national surveillance across France.

view details
October 27 2020
New Publication in ASM's Clinical Microbiology Reviews
SmartGene's scientists are co-authors of an important, wide-ranging article which addresses the role of gene sequencing for the specific identification and characterization of bacteria. Published by the American Society for Microbiology in Clinical Microbiology Reviews, the article is entitled: Performance and Application of 16S rRNA Gene Cycle Sequencing for Routine Identification of Bacteria in the Clinical Microbiology Laboratory.
view details
October 14 2020
SmartGene Bacteria Technology Featured in new Application Note published by Thermo Fisher Scientific

SmartGene's Bacteria Module is the perfect complement to the Applied Biosystems SeqStudio™ Genetic Analyzer. 

view details
April 28 2020
SmartGene announces new SaaS Module for Coronaviruses

Genetic analyses of SARS-CoV-2 and other Coronaviridae will have an increasingly important role to play, both in the current fight against COVID-19 and in preventing future epidemics of Coronaviridae.

view details
January 28 2020
Influenza references updated

The reference sequences available in SmartGene's Influenza module have been updated.

view details
January 23 2020
Hepatitis Collaboration

SmartGene announces a clinical research collaboration with France's Centre of Excellence for the study and treatment of hepatitis viruses at the Virology Laboratory and National Reference Center for Viral Hepatitis B, C, and delta at Hospital Henri Mondor, University Paris-Est, Paris, France.

view details
September 12 2019
Fungal 25-28S references updated

The IDNS Fungi 25-28S Reference Database has been reconfigured to improve coverage and species representation. 

view details
January 15 2019
21 CFR Part 11 Certification

SmartGene receives certification of compatibility regarding the requirements of Title 21 Part 11 of the US Code of Federal Regulations.

view details
June 07 2017
On day one of the 15th European Meeting on HIV & Hepatitis in Rome, Italy, 7-9 June 2017

Professor Anne-Geneviève Marcelin of Pitié-Salpêtrière Hospital Sorbonne, Paris, France presented the findings of a study based on data collected and analyzed using tools and search algorithms which SmartGene has made available for this purpose: Epidemiological study of Doravirine associated resistance mutations in HIV-1-infected treatment-naïve patients from two large databases in France and Italy.

view details
November 11 2016
SmartGene announces Advanced Sequence Analysis Platform for NGS

With the release of version 5.3, SmartGene has applications available for HIV, Microbiome 16S, and HCV.

view details

Page 2 of 3

  • Start
  • «
  • 1
  • 2
  • 3
  • »
  • End
  • Contact Headquarters
  • Contact North America
  • About SmartGene
    • History
    • Careers
    • News
  • Legal Statement
  • Privacy
  • Cookies
  • Sitemap
© 2023 SmartGene AG. All rights reserved.
  • Home
  • Our Services
    • Apps
      • Bacteria
      • Bacteria for SeqStudio™
      • Fungi
      • Microbiomes
      • HIV
      • HCV
      • Influenza
      • Coronaviruses
      • Typing
      • NGS Apps
      • Other Apps
    • IDNS Technology
    • IDNS Networks
    • Consulting
  • Markets we serve
    • Clinical Diagnostics
    • Medical Research
    • Public Health
    • BioPharma
    • Food Integrity
  • Scientific Publications
  • Contact Us
    • Job Opportunities
  • Customer Area
    • FAQs
    • Request for account access
      • Europe, A4 format
      • North America, letter format